dysphagia a water soluble contrast swallow reveals a massively dilated blind loop with a large deposit of contrast and a very slow passage through the roux loop
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot
Ngày tải lên :
14/08/2014, 17:22
... [45] Additional data files The following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and ... if they had at least two peptides with score higher than 35 For Orbitrap data, the criteria were a mass accuracy within ppm (average absolute peptide mass accuracy was 1.22 ppm) and at least ... using the Protein Center tool (v0.62, Proxeon Biosystems) Data Our data are freely available at the proteome database of the department of proteomics and signal transduction of the Max-Planck-Institut...
- 11
- 289
- 0
Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx
Ngày tải lên :
22/02/2014, 05:20
... usually begin as operators of conventional dairies that go through what can be a challenging and costly transition process Many changes in such areas as animal husbandry, land and crop management, ... farms adopting the organic approach because of access to high quality pastures and the ability to manage pasture as a dairy feed source These areas also have a long history of small dairy operations ... Survey (ARMS) of U.S milk producers The ARMS data include detailed farm financial information, such as farm income and expenses, and farm assets and debt, as well as farm and operator characteristics...
- 30
- 660
- 0
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
Ngày tải lên :
09/08/2014, 10:23
... in RA Variation in the HLA-DRB1 gene of the MHC is more strongly associated with RA than variation in any other locus The variation maps to the third hypervariable region of the DRβchain and ... Yoshitomi H, Sakaguchi N, Kobayashi K, Brown GD, Tagami T, Sakihama T, Hirota K, Tanaka S, Nomura T, Miki I, Gordon S, Akira S, Nakamura T, Sakaguchi S: A role for fungal {beta}-glucans and their receptor ... H, Iwakabe K, Yahata T, Nishimura S, Ohta A, Ohmi Y, Sato M, Takeda K, Okumura K, Van Kaer L, Kawano T, Taniguchi M, Nishimura T: The natural killer T (NKT) cell ligand alphagalactosylceramide...
- 9
- 406
- 0
Báo cáo y học: "Magnitude and determinants of nonadherence and nonreadiness to highly active antiretroviral therapy among people living with HIV/AIDS in Northwest Ethiopia: a cross - sectional study" ppsx
Ngày tải lên :
10/08/2014, 05:21
... initial and final drafts of the manuscript FE and US interpreted the results, and reviewed the initial and final drafts of the manuscript All the authors read and approved the final manuscript ... was the primary researcher, conceived the study, designed, conducted data analysis and drafted the manuscript for publication FB, AM and AG assisted in data collection and reviewed the initial ... methods of interviewing was given and the English version questionnaire was translated to the local language (Amharic) Institutional ethical clearance was obtained from the research and publication...
- 8
- 375
- 0
Báo cáo y học: " A multiscale mathematical model of cancer, and its use in analyzing irradiation therapies" ppt
Ngày tải lên :
13/08/2014, 23:20
... therefore developed a multiscale mathematical model of these processes to study the efficacy of radiotherapy Several mathematical frameworks have been developed to model avascular and vascular ... activated and the cells are labeled as 'DNA damaged cells' DNA damaged cells are identified at the R point of the cell cycle and are directed to apoptosis They die and disappear from the computational ... remain in the quiescent phase in the absence of external changes, otherwise they may return to the proliferative cycle (at the first step of S phase) DNA damage can also activate the p53 pathway,...
- 19
- 315
- 0
Báo cáo y học: "A non-random walk through the genome" pdf
Ngày tải lên :
14/08/2014, 14:21
... on the array must be taken into account, as non-random hybridization across the array landscape is often significant: for example, some early arrays had probes printed in the same order as they ... that a typical mammalian nucleus is 50-100 times larger than a yeast nucleus Given that it is known that a gene locus in both yeast and mammals has a similar random motion, exploring a sphere about ... non-randomly within the volume of the nucleus In plants, flies and yeast, chromosomes are often arranged with their telomeres clustered at one end of the nucleus and their centromeres associated with...
- 6
- 289
- 0
A study on the reality of teaching and learning English pronunciation skills to the 11th graders at Kien An high school =Nghiên cứu thực trạng dạy và học kỹ năn
Ngày tải lên :
28/03/2015, 09:33
... especially in vocabulary and grammar part, because vocabulary and grammar are useful for tests and examinations In short, it can be said that teaching materials the teachers used to teach pronunciation ... data analysis above reveals the truth that the majority of teachers and students at Kien An high school suppose teaching and learning grammar and vocabulary is much more necessary than teaching and ... chapter Chapter III: Data Analysis and Findings analyzes the collected data to answer the three research questions and shows the findings of the reality of teaching and learning pronunciation at...
- 60
- 1.3K
- 5
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
Ngày tải lên :
18/03/2014, 01:20
... Sense Antisense 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢ 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢ 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢ 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢ 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢ 5¢-GGGCTATTCTTTCATCATCCTCATCG-3¢ ... of AAC2 from rat, AAC1 from potato and AAC3 from Arabidopsis are much higher than those of the AAC1 and AAC2 isoforms from Arabidopsis and AAC1 from rat The hydrogenosomal AAC from Neocallimastix ... 5¢-GGGCTATTCTTTCATCATCCTCATCG-3¢ 5¢-TTAAACGTTcatATGGCAGATATGAACC-3¢ 5¢-GGAAGTTACGAGGCTGACTTAGGC-3¢ 5¢-GCGCCCGCGTTTCcatATGGGGGATCAG-3¢ 5¢-CCACACAATGGATCTGTGAACCTGTG-3¢ 5¢-CTTTTTTGCTTTCcAtATGACAGATGCCG-3¢...
- 10
- 486
- 0
provisional standard test method for water-soluble chloride available for corrosion of embedded steel in mortar a
Ngày tải lên :
24/10/2014, 17:40
... responsibility of the user of this test method to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use 2—Significance and Use 2.1 Water- soluble ... the sample compartment, and a condenser The extractor contains approximately 100 ml of distilled water in the lower flask Heat is applied to this flask; vapor from the boiling water passes to the ... extractor Add a wad of glass wool Place approximately 100 ml of deionized water in the lower flask 7.2.1 Assemble the condenser complete with cooling water supply pipes to the extractor and place...
- 3
- 344
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
Ngày tải lên :
19/02/2014, 16:20
... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... substrate specificity and the cofactor References Hasegawa, Y., Muraki, T., Tokuyama, T., Iwaki, H., Tatsuno, M & Lau, P.C (2000) A novel degradative pathway of 2-nitorobenzoate via 3-hydroxyanthranilate ... Bacteriol 183, 5074–5081 Aoki, K., Takenaka, S., Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol...
- 7
- 613
- 1
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
Ngày tải lên :
06/03/2014, 21:20
... pollutants to such an extent that the quality of the ambient water remains above agreed water quality standards Operational water footprint – The amount of freshwater used for the operations of a ... located, the actual competition over the water in these local systems and the negative externalities associated with the use of the water Assessing the impact of a water footprint requires an additional ... defined as the sum of the evaporation of irrigation water from the field and the evaporation of water from 16 / Business water footprint accounting irrigation canals and artificial storage reservoirs...
- 46
- 959
- 0
a consumer guide to accompany the australian drinking water guidelines
Ngày tải lên :
13/05/2014, 14:41
... appearance of the water After many years of research, the Australian Water Quality Centre and the South Australian Water Corporation, in collaboration with CSIRO and Orica, has developed a new resin, ... training in Australia and supports many of the medical advances made by Australians The NHMRC also develops guidelines and standards for the ethical conduct of health and medical research The ... water from soil and rocks, are good for human health and give the water a pleasant taste Other impurities can a ect the aesthetic qualities of water such as appearance, taste, smell and ‘feel’ Such...
- 30
- 566
- 0
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
Ngày tải lên :
19/06/2014, 10:20
... classifying a vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually ... Figure Sample swallow signals on the left and aspiration signals on the right Sample swallow signals on the left and aspiration signals on the right Note that swallows are typically longer in duration ... prior to each child's participation The protocol was approved by the Research Ethics Board of Bloorview Kids Rehab (Canada) The mean age of the participants was 6.0 ± 3.9 years with 64 males and 53...
- 17
- 497
- 0
Báo cáo lâm nghiệp: "Amounts of throughfall and lysimetric water in a sub-mountain beech forest in the Kremnické vrchy Mts" ppt
Ngày tải lên :
07/08/2014, 03:22
... interaction with plants, soil, and water balance – which was already pointed out by Papritz et al (1991) and Flückiger and Braun et al (1992) The differences in the soil water balance between the ... On average, of the total amount of gravitational water from the soil surface only 65.6% reached the depth of 10 cm and only 26.2% percolated into the depth of 25 cm In the opened plot, the values ... a finding that only 54–71% of the amount of water fallen on the plot without stand cover reached the soil under the parent stand Dubová (1996), reports in this context a value of 70% on average...
- 5
- 400
- 0
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
Ngày tải lên :
09/08/2014, 06:23
... Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflammation and RAGE: a scaffold for the macrovascular complications of diabetes and beyond Circ Res 2003, 93:1159-1169 Hofmann MA, Drury S, ... in plasma or synovial fluid Perspectives The work of Pullerits and colleagues adds to the growing body of human data on RAGE, sRAGE, genetic variants and inflammation These investigators placed ... inflammation It remains unclear whether methotrexateinduced suppression of inflammation facilitated the generation/ stability of endogenous sRAGE and, thus, ligand-trapping and reduced inflammation...
- 3
- 368
- 0
báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
Ngày tải lên :
10/08/2014, 10:21
... PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor gene - Q223R aaactcaacgacactctcctt tgaactgacattagaggtgac PCR-RFLP ... data analysis and participated in drafting of the manuscript, MS performed biochemical analysis, performed data analysis and participated in drafting of the manuscript, WB consulted the results and ... 18G > A and the leptin receptor genes K109R and Q223R, and overweight status at ALL diagnosis and after ALL treatment was found No statistically significant correlation between variants of the...
- 9
- 356
- 0
Báo cáo y học: " Primary localized laryngeal amyloidosis presenting with hoarseness and dysphagia: a case report" ppt
Ngày tải lên :
11/08/2014, 14:21
... bronchotracheal tree and lungs [6] Oral and paranasal amyloidosis is usually a manifestation of systematic amyloidosis, mainly plasma cell dyscrasia [7] Laryngeal amyloidosis usually appears during the ... sites are the eye, the orbits and the major and minor salivary glands, while submucosal deposits have been observed in the nose, paranasal cavities, nasopharynx, oral cavity, stomatopharynx, ... amyloidoses with AL, AA, AK types of amyloid Table summarizes the classification of amyloidosis with the accompanying amyloid type Localized amyloidosis occurs in a variety of organ systems Both Table...
- 5
- 303
- 0
Báo cáo y học: "Diffuse idiopathic skeletal hyperostosis as an overlooked cause of dysphagia: a case report" pdf
Ngày tải lên :
11/08/2014, 21:22
... tumours and candidiasis [8] Other clinical manifestations associated with cervical DISH are hoarseness, stridor, aspiration pneumonia, myelopathy, thoracic outlet syndrome and sleep apnoea [7] Treatment ... diagnosis of DISH is radiological Plain radiographs of the cervical spine typically show flowing calcification and ossification along the anterior surface of at least four contiguous vertebrae ... most marked at showing anterior Lateral radiograph of the cervical spine the C3/C4 vertebrae Lateral radiograph of the cervical spine showing anterior osteophyte formation most marked at the C3/C4...
- 3
- 399
- 0
Báo cáo y học: "Posterior mediastinal melanoma causing severe dysphagia: A case report" doc
Ngày tải lên :
11/08/2014, 21:22
... characteristics of metastatic melanoma occurring as a mediastinal mass Lau et al [3] discussed the case of a patient with a malignant melanoma presenting as an anterior mediastinal mass consistent with lymph ... 40°C The initial radiological assessment consisted of a chest Xray showing a large right paratracheal mass A computed tomography (CT) scan confirmed, at the level of the thorax, the presence of a ... Surgical specimen In our case, the absence of a primary malignancy together with the lack of skin nodal basin involvement suggested a nodal origin rather than a metastatic localization from a skin...
- 4
- 231
- 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
Ngày tải lên :
13/08/2014, 16:20
... between the cells of the SC (intercellular pathway), (2) through the cells of the SC, and (3) through appendages such as hair follicles and sweat glands Although the relative importance of each is ... simplifications, and modellers must find a balance between an adequate representation of the physical phenomena (which may vary, depending on the focus of the study) and the associated computational ... is the capillary rise and Pw is the capillary pressure between water and air in the porous medium Thus, we refer to “capillary head”, and the difference between the head pressures at the top and...
- 25
- 373
- 0